16
0

Fauci Created The Virus To Sell The Murderous "Vaccine"


9,693 views  393 comments             share      

by Patrick   $0.28 total tips   💰tip   follow   2021 May 23, 12:00pm  

How come this fact is not at the top of "alternative" press? The corporate press is of course part of Fauci's murderous corruption.

This is perhaps the greatest crime against humanity ever committed by a small group of people: Fauci, Daszak, and the Bat-lady in Wuhan.

https://patrick.net/post/1339251/2021-05-16-incredibly-long-detailed-evidence-that

There should be nothing else in the headlines, only this.

Fauci has a long history of funding gain-of-function research to facilitate the creation of viruses which can be used to sell vaccines for large profits.

Anyone who has read a decent mystery novel will see the means, motive, and opportunity were all there. It's obvious in retrospect.

Until Fauci is in jail, we are all in danger of his doing it again, and again, and again, or having some minion like Daszak do it. Why is there no official investigation going on?



« First    « Previous    Comments 303 - 342 of 393   Next »    Last »

304   Patrick   2022 Feb 20, 3:31pm  

https://rwmalonemd.substack.com/p/sunday-news-round-up?source=patrick.net


This week, in response to ongoing litigation over the release of public records related to coronavirus research funded by National Institutes of Health, the NIH sent The Intercept (magazine) 292 fully redacted pages rather than substantive material that they requested. These pages could have helped us to understand how the virus first came to infect humans. Below is one of the 292 pages that The Intercept received:

In order words, The Intercept received 292 completely blanked-out pages and a few pages almost completely redacted. So, what is the NIH hiding when it comes to their role in the gain of function research that developed the SARS-CoV-2 virus that causes COVID-19?



305   Patrick   2022 Feb 23, 11:36am  

https://www.dailymail.co.uk/news/article-10542309/Fresh-lab-leak-fears-study-finds-genetic-code-Covids-spike-protein-linked-Moderna-patent.html?source=patrick.net


More evidence Covid was tinkered with in a lab? Now scientists find virus contains tiny chunk of DNA that matches sequence patented by Moderna THREE YEARS before pandemic began
Genetic match discovered in Covid's unique furin cleavage site on spike protein
Matched genetic sequence patented by Moderna for cancer research purposes
Researchers say one in 3trillion chance Covid developed the code naturally

23 February 2022
306   Patrick   2022 Feb 24, 9:58am  

https://www.genengnews.com/topics/omics/moderna-wins-initial-20m-grant-from-gates-foundation/?source=patrick.net


Moderna Wins Initial $20M Grant from Gates Foundation
January 12, 2016

Moderna Therapeutics said today it received an initial $20 million grant from the Bill & Melinda Gates Foundation to develop a new affordable combination of messenger RNA–based antibody therapeutics geared toward preventing HIV infection.


And then parts of HIV are found in Moderna's mRNA injection. Hmmm.
308   Patrick   2022 Mar 2, 10:04am  

Fauci must be absolutely loving the war in the Ukraine as a distraction from his crimes against humanity.
309   Patrick   2022 Mar 3, 8:55pm  

https://dossier.substack.com/p/wheres-fauci-infamous-bureaucrat?source=patrick.net


Where’s Fauci? Infamous bureaucrat now relegated to obscure shows and local TV
Fauci recently appeared on a show called “Woke AF.”
311   RWSGFY   2022 Mar 4, 8:44am  

zzyzzx says


Did Rand Paul let go of the idea of locking him up?
313   Patrick   2022 Mar 4, 10:11am  

RWSGFY says
Did Rand Paul let go of the idea of locking him up?



I wish I could tell.

Fauci should absolutely be locked up, first for creating the virus, secondly for lying about it to Congress.
316   RC2006   2022 Mar 31, 8:56pm  

https://www.instagram.com/tv/CbxlmzHDwo_/?source=patrick.net

Fauci telling reporter if you got the flu you dont need flu shot.
317   Patrick   2022 Apr 2, 12:39pm  

https://www.vanityfair.com/news/2022/03/the-virus-hunting-nonprofit-at-the-center-of-the-lab-leak-controversy?source=patrick.net

In 2014, Fauci’s agency had issued a $3.7 million grant to EcoHealth Alliance, a nongovernmental organization dedicated to predicting and helping to prevent the next pandemic by identifying viruses that could leap from wildlife to humans.


They still don't get it.

The grant to EcoHealth was to create the virus in order to sell the vaxx.
318   Shaman   2022 Apr 2, 1:20pm  

Just a few of the symptoms my once/jabbed friend is experiencing.


And a little idea of your risk should you take a jab…

319   Patrick   2022 Apr 2, 7:23pm  

https://www.c-span.org/video/?c5008848%2Fuser-clip-natural-immunity-dr-fauci=&source=patrick.net

Video of Fauci admitting that the most potent "vaccination" is to have been infected and recovered.

And yet he then went on to lie that people who recovered from Wuhan Virus should get the dangerous and ineffective vaxx. Why? I can think of billions of dollars why.
320   Patrick   2022 Apr 4, 10:31pm  

https://www.vanityfair.com/news/2022/03/the-virus-hunting-nonprofit-at-the-center-of-the-lab-leak-controversy?source=patrick.net

https://brownstone.org/articles/faucis-united-front-is-collapsing/?source=patrick.net


What is unbearably clear at this point is that this gang’s obsession with covering up a possible lab leak, in the interest of keeping their own fingerprints off the deed, completely distracted the leadership of the National Institutes of Health from what it was supposed to be doing at the time. And what was that? It’s not complicated. If you have a new pathogen sweeping a country, you want to focus on ways to keep vulnerable populations safe (for example, not forcing nursing homes to admit Covid-infected people) and discovering the best therapeutics to minimize severity for the general population.

This is not what happened. Instead, we had a plot against the US president, the deliberate cultivation of mass panic, forced closures of schools and businesses, wild demands for mass human separation, travel restrictions, ineffective mask and vaccine mandates, and the general triumph of crank science over experience, at the great cost of human liberties and rights and hence social and economic well-being.
321   Patrick   2022 Apr 8, 10:11pm  

https://ashmedai.substack.com/p/gain-of-function-smashing-success?s=r&source=patrick.net


Gain-of-Function Smashing Success: The Key Sequence Inserted in the SARS-CoV-2 Virus Added at Least FOUR Distinct Functions. Coincidence?
Unpacking the evil genius of TATCAGACTCAGACTAATTCTCCTCGGCGGGCACGT

Ashmedai

If Fauci was a hedge fund manager, he would outperform the stock market by a wide margin. The man always gets his money’s worth from the numerous grants worth billions of dollars that he dispenses annually. His track record of producing the desired research results is so consistent that Vegas would be quickly bankrupted if they would allow people to bet on what the results of a Fauci-sponsored study would be. And as we shall see, the ROI for his Gain-of-Function grants was absolutely stupendous.

There is heightened interest in the origin of covid-19, especially now that the world has more or less acknowledged its likely laboratory provenance. A veritable flood of documents have been publicized chronicling the progress and evolution of the gain-of-function research and experiments leading up to the “emergence” of covid. ...

Alarmingly, the scientists who designed the vaccines were incredibly sloppy and shortsighted. In their myopic desire to squeeze out every last drop of potential protein production, they put all their efforts into ensuring that the mRNA wouldn’t degrade and maximizing the yield of every strand of mRNA to the extent humanly possible. One of the tactical choices made was employing codon optimization all throughout the spike genome. (There were a few other reckless choices as well.) They never considered that recklessly modifying the virus genome for the vaccine product could lead to unintended consequences. ...

Ultimately, we have no idea of what potentially toxic mutant peptides might be produced in relevant quantities, and where in the anatomy such toxicities might be manifest; and nor do we know how this affects the immune system. That we are burdened by such profound unknowns regarding the vaccine products is a testament to the utter and complete collapse of the regulatory regime.
322   zzyzzx   2022 Apr 27, 6:08am  

https://www.dailymail.co.uk/news/article-10756421/Oklahoma-GOP-chairman-calls-Fauci-shot-firing-squad-mask-vaccine-mandates.html?source=patrick.net

Oklahoma GOP chairman calls for Dr. Fauci to be 'put in front of a firing squad' for 'forcing' mask and vaccine mandates on Americans
323   Patrick   2022 May 11, 9:09pm  

https://tobyrogers.substack.com/p/the-five-pandemics-driving-1-million?s=r&source=patrick.net


Democrats now interpret all data through the lens of The Narrative(TM) that makes Dems look like heroes, Pharma look like Gods, and Republicans look like unwashed barbarians who deserve death for their failure to obey their betters. It’s not so much science as bougie-supremacy. Self-reflection, paradox, and admitting mistakes are of course banned from the bougie lexicon.

In this short article, I’ve stolen his title (in hopes of messing with the search engines) and I set the record straight. Any honest assessment of the last two years leads to the inexorable conclusion that every facet of the pandemic is a direct result of the intellectual and moral failures of the “expert class” itself.

1. Tony Fauci created the pandemic by funding risky gain-of-function research at a bioweapons lab in Wuhan China. Somehow a chimera virus, engineered to be more lethal to humans, escaped. No Tony Fauci, no pandemic. All else flows from this.

2. Fauci, the FDA, and CDC blocked access to prophylaxis and early treatment. The CDC’s own research showed that chloroquine is safe and effective for prophylaxis and early treatment of SARS coronaviruses (hydroxychloroquine is even safer than chloroquine). The U.S. had a massive stockpile for this very purpose that was never used. About 90% of Covid-19 fatalities in the U.S. could have been prevented if public health officials had followed proper protocols and used about twenty off-the-shelf treatments that are safe and effective. Instead the FDA and CDC ridiculed the best treatments, stopped doctors from prescribing them, and prohibited pharmacies from filling these prescriptions.

3. Hospitals used the wrong protocols and continue to use the wrong protocols. Failing to provide early treatment (turning people away from hospitals to preserve capacity), ventilators, and Remdesivir are all death sentences. Large hospitals have such abysmal outcomes because they used the wrong protocols and they seem to have no ability to course-correct based on actual data.

4. Blue states that followed the CDC’s advice to return Covid+ patients to nursing homes committed senicide — the systematic murder of the elderly. The death toll in the elderly was and is so high because they were never provided prophylaxis, immune support, nor any early treatment and their residences were intentionally seeded with the sick — once again in the misguided attempt to preserve hospital capacity(TM).

5. Promoting mass injections with negative efficacy, keeps the pandemic going indefinitely. These useless shots also seem to be driving the evolution of variants. The pandemic will never end as long as the government continues to promote these mRNA shots that lack sterilizing immunity.

The entire pandemic, from the origins, through the early days, until now, is a self-inflicted, man-made crisis. This is iatrogenic pandemicide — created, spread, and made more deadly by the people who claim that they are “experts”. Everything that public health has done for two years has made things significantly worse. As long as the people who are wrong about everything remain in power, the crisis will continue.
326   Patrick   2022 May 13, 8:22pm  

https://amgreatness.com/2022/05/12/nih-director-confirms-agency-hid-covid-genes-on-orders-from-the-chinese/

On Wednesday, Lawrence Tabak, the acting director of the National Institutes of Health (NIH), confirmed during congressional testimony that officials at the NIH deliberately withheld crucial information about early genomic sequences of the COVID-19 virus on the orders of Chinese scientists.
331   Patrick   2022 May 19, 9:54pm  

Fauci is still at it.

https://dossier.substack.com/p/the-next-big-scare-usa-and-europe


Health authorities in the two continents have thus far identified only a few dozen cases. And while there’s no reason for concern at the moment, here’s what convinced me to put this on your radar.

Late last night, the U.S. government decided to order millions of doses of monkeypox vaccine. ...

The U.S. likely has first dibs on the product because the vaccine was developed with American support. Anthony Fauci’s NIAID has supported Bavarian Nordic with well over $100 million in grants. Whether Fauci and his colleagues will receive kickbacks and royalties for this vaccine remains unknown.

Bavarian Nordic received FDA approval for its vaccine in September of 2019, just two months before the commencement of COVID Mania. ...

Early reports from Europe seem to indicate that Monkeypox is only spreading within the gay community, as cases are being reported exclusively in gay men. The transmission dynamics remain unclear, but that hasn’t stopped the usual panic promoters from making hysterical claims.
333   Patrick   2022 May 23, 1:58pm  

https://boriquagato.substack.com/p/fauci-on-smallpox-vaccines


i like to allow people to state their positions in their own words. it’s no fair making up what they said or paraphrasing to rob them of nuance and of full expression.

so hear tony out.

because he speaks here with clarity and with nuance.

the year was 2017. he’s speaking about the smallpox vaccine. and he clearly understands risk/reward.

smallpox is a disease FAR deadlier than covid.

the smallpox vaccine has a severe adverse events rate that is easily 1/100th that of the covid vaccines (and probably quite a lot less than that. could easily be 1/1000th or less)

AND it’s a one and done vaccine. you get the shot and you generate lifelong sterilizing immunity. you won’t get smallpox or spread it. you really are the “dead end” tony famously claimed the covid vaccinees would be.

and yet he says we should not bring it back because the vaccine has some rare side effects and this outweighs the benefit.



335   Patrick   2022 May 24, 1:25pm  

https://thenationalpulse.com/2022/05/22/wuhan-assembled-monkeypox-strains/


The Wuhan Institute of Virology assembled a monkeypox virus genome, allowing the virus to be identified through PCR tests, using a method researchers flagged for potentially creating a “contagious pathogen,” The National Pulse can reveal.
337   WookieMan   2022 May 24, 2:17pm  

Patrick says

https://www.infowars.com/posts/united-states-dod-issued-a-contract-for-covid-19-research-in-ukraine-3-months-before-covid-19-officially-existed/

Look up Puerto Rico and birth control. We've been fucking around with major science for a century.

It's highly probable that we have cures for cancer. 10's maybe 100's of thousands would lose their jobs overnight. Maybe millions now that I think about it. Less researchers, nurses, doctors, etc. Human nature does not allow you to claw back something that makes you money. Sad, but true. The fact Trump lowered Federal taxes is kind of amazing in hindsight. Rarely does the government cut.
338   Patrick   2022 May 28, 10:43am  

https://gettr.com/user/EdwardDowd


Edward Dowd
@EdwardDowd
·
May 25
The fictional character Patrick Bateman was an amateur compared to the current crop of real world mass murdering American Psychos.




Even looks like Fauci.
339   Patrick   2022 May 29, 1:27pm  

https://tobyrogers.substack.com/p/fda-announces-updated-schedule-for


Tony Fauci and the NIAID funded the creation of a chimera virus that escaped a bioweapons lab and killed 6.3 million people worldwide.

Public health authorities have blocked access to safe and effective prophylaxis and early treatment throughout the pandemic in order to create the market for Covid-19 vaccines.

Covid-19 shots skipped essential safety steps (e.g. challenge trials in animals) and were rushed to market with no long term data.

In practice the mRNA shots suppress immune function for 6 weeks after the first shot, provide about two months worth of protection against coronavirus, then efficacy wanes quickly and becomes negative after six months. Meanwhile, these shots cause more side effects than any vaccine ever invented.

Popular support for the current regime has collapsed. More people have died of Covid under Mr. I Believe the Science(TM) than under Orange Man Bad. Only hypochondriacs in blue states seek out additional doses. Meanwhile Sudden Adult Death Syndrome stalks the true believers. In the past 48 hours alone actor Ray Liotta, Andy Fletcher of Depeche Mode, British drummer Alan White (from the band YES), and comedian Phil Butler were all likely killed by Covid-19 shots. It’s impossible to hide all of the bodies at this point.

The FDA seems to know that their window is closing to implement the Final Solution. So they are rushing to put the finishing touches on their plans to inject this toxic junk into the littlest kids in America. The FDA knows that these shots cannot pass proper regulatory review so they’ve developed a plan to rig the process in favor of Pharma in perpetuity. On June 28, the FDA’s “expert advisory committee” will vote on a “Future Framework” whereby all future (reformulated) Covid-19 shots will automatically be deemed “safe and effective(TM)” without any additional clinical trials, on the theory that they are “biologically similar” to existing Covid-19 shots.

What this means is that by fall, the Covid-19 shots that they will be injecting into Americans of all ages will have a new formula that skipped clinical trials altogether.

Injecting people with genetically modified mRNA that skipped clinical trials is genocide. It’s slower than the Nazi Final Solution. But it’s genocide all the same. Indeed the slower pace of the FDA Final Solution (5% to 15% increase in all cause mortality every year) might be even more lethal in the long run. It’s sinister af that they are intentionally building in plausible deniability (‘the FDA said it was safe’) to help the medical establishment feel virtuous while participating in genocide.

I’ll just conclude by saying: be careful what you wish for FDA. The tide has already turned. The American people know exactly what you are doing. We have the receipts. It will be relatively easy to secure a conviction at Nuremberg 2.0 — we literally have you on video committing crimes against humanity. As a reminder, the courts have determined that “I was just following orders” is not a valid defense.
340   Patrick   2022 May 30, 10:33pm  

https://thenationalpulse.com/2022/05/30/fauci-funded-monkeypox-virus-treatment-study/


Fauci’s agency, the National Institute of Allergy and Infectious Diseases (NIAID), has previously come under scrutiny for funding bat coronavirus research at the Wuhan Institute of Virology, which many public health experts and intelligence officials believe to be the source of COVID-19.

NIAID has also funded research into potential cures for monkeypox, shortly before the viral disease began spreading in a global outbreak. The curious timing of the NIAID grant comes amidst pharmaceutical giants including Pfizer and Johson & Johnson making record-level profits due to the COVID-19 pandemic.

The grant supports a “randomized, placebo-controlled trial of the safety and efficacy of tecovirimat for the treatment of patients with monkeypox virus disease.”

“The funding supports a clinical trial to identify effective treatments for monkeypox virus disease,” explains a summary of the research, which, despite beginning in September 2020, has not generated any publicly available studies, papers, or patents.
341   Patrick   2022 May 31, 9:36am  

https://spectatorworld.com/topic/fauci-harvard-and-the-ccp/


The Harvard connection
Was a Fauci-endorsed Chinese donation part of the lab-leak cover up?

May 26, 2022
342   Patrick   2022 May 31, 9:51pm  

https://www.thegatewaypundit.com/2022/05/executive-director-oxfam-brags-audience-world-economic-forum-covid-one-profitable-products-ever-video/

Executive Director of Oxfam Tells Audience at World Economic Forum – “COVID Has Been One of the Most Profitable Products Ever” (VIDEO)

« First    « Previous    Comments 303 - 342 of 393   Next »    Last »

Please register to comment:

about   best comments   contact   latest images   one year ago   random   suggestions