patrick.net

This is important enough that we should copy it:

Can you prove me wrong or right about Coronavirus? Apparently, this is the only sub left you can discuss it without triggering the normies. I posit the following:
Meta
There is one reference genome. One. Provided by Wuhan. No one else has been able to sequence a SARS COV 2 genome. Why? Because they digitally mocked up a chimera in order to trigger as many false positives as possible.

WTF do I mean?

When you need to sequence a genome, you have to blow apart many cells many times and reverse engineer the correct order. The way to do this is to line up the first 4 or 5 nucleotides. So, say you have a 24 nucleotide sequence; they are only looking at the first and last 5 nucleotides to make a match.

Let's say you get some of your thousands and thousands of pieces isolated. They will look like this...

CAGUAGCUAGAUACGAUAGCAUUAGC

ACGUACGUACGUACGUACGUGAUC

AGCUGAUCGAUCGAUCGAUCACGU

GAUCGAUCGAUCGAUCGAUCCAGU

Your reference genome is going to be thousands of characters. I won't bother demonstrating.

You can see how 1 and 4 have ends that overlap and, with enough data, enough cells and cell fragments, we can reliably figure out the right order. With too little data, we can say anything we want.

But imagine if someone digitally mocked up a genome made up of as many pairings as possible to allow for the highest statistical probability of showing positive.

The genome sequencing, if you were to ask for it, would result in them exploding a sample of your infected cells, then subtract out everything they don't want to see... influenza, adenovirus, rhinovirus... whatever. So, even if you have these things, they are eliminated because the sequencer is using the reference genome provided by Wuhan and subtracting all potentially irrelevant data.

The sequencing only looks for segments that match the reference genome.

The BLAST database houses all this data. You can go check for yourself.

While the CDC touts 280k samples have been sequenced, the longest chain I found (after looking through them one by one for a couple of hours) was a 14 nucleotide chain. Most of the submissions were from 30 to 40 random segments of merely small pairs.

This data seems so fake.

You can purportedly order SARS COV 2 for laboratory testing. I have yet to see anyone sequence a full genome beyond what Wuhan provided, but they are clinging to this shit like saran wrap.

Further proof exists in the BS testing. Antigen, antibody and PCR (PCR tests indicate contraindications with other coroanvirus strains on the package) tests all show as positive for every coronavirus strain. Surprise... all human affecting coronaviruses have the S spike protein and the body responds to its presence by adding a CR3022 protein into the polyprotein chain that makes up white blood cells.

CR3022 blocks S spike protein from attaching to your cells. Why make an RNA vaccine when inactive S spikes (like every other previous vaccine and like the vaccines China made for their people) will cause the body to make CR3022?

Think about that. We can make a vaccine that is simple, old fashioned and causes the same result. Why in the F do we need to inject RNA when the Chinese already had a vaccine ready without it, when everyone already knew about S spike proteins and CR3022?

How is it that two totally different types of vaccines were ready to go? How is it that, all over the world, Russia, America, China and many others miraculously found the cure immediately and at almost exactly the same time?

And what happens when you use S spike proteins to block ACE2 receptors in your ovaries and testes? Beyond the metabolic manipulation that can make you slower and more lethargic, oocyte meiosis can be stalled as well as spermatogenesis.

But don't take my word for it...

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3821659/

alterations in the expression of angiotensin-converting enzyme-1, angiotensin-converting enzyme-2, and angiotensin-converting enzyme-3 might be one of the most important mechanisms underlying both female and male infertility.

The study plainly states that there are ACE2 receptors in the ovaries and testes and that blocking these receptors will possibly suspend oocyte meiosis and spermatogenesis.

there is no doubt that ACE1 and ACE2 have gained recognition as significant regulators of the physiology and pathology of the reproductive system.

Of course, all the relevant data is proprietary. You're not allowed to know what's in the vax beyond a few basic ingredients.

Combine this with the bunk face mask science, where you're just wearing a petri dish of fungus and bacteria on your faces... maybe the occasional amoeba, if you're lucky, and no one you voted for has proven trustworthy. They were either dishonest or too stupid to be in charge but they told morons what to do and morons obeyed without any critical thought. Any.

If that isn't enough, in 2015, the World Bank planned for a coronavirus pandemic with their Pandemic Bonds set to expire March 2020.

If that isn't enough, 9chan accessed the Wuhan Institute of Virology and WHO to prove it was a scam... maybe someone can find screenshots, mine are missing.

The COVID scam is unconventional warfare whereby words and huge astroturfing campaigns were brought to bear to shut down the entire US Military and send them home for a year. They took out a carrier because the Chinese loyalist captain was in on it.

Your economy was crashed and everyone you allow to be in charge of you was in on it, profiting from it, politicians invested and skilled and locked you in your homes because they are seditious. They hate you and you worship these paid shills. Athletes, politicians, actors, actresses... stop worshipping these fools. They helped this whole thing along.

In fact, 1 Billion in astroturfing was paid for by the US government at the behest of vaccine companies to astroturf in favor of the vaccine.

A billion dollars.

All information is curated and anyone who demonstrates the science to be wrong is deplatformed.

And you all do nothing, as far as I can tell. Happy to watch a stolen election go by. Happy to watch Joe Biden on video, in October 2019, talking about the pandemic that will unseat Trump.

The whole thing was planned for years.

Astroturfers/shills are actual seditious conspirators against the country and against you and deserve the traitors due.

Meanwhile, hospital data all over the world is being deleted via ransomware. California, Ireland, New Zealand... and many more. Schools. City governments.

The ransomware isn't just seizing the computers, it has also been leaking all the data to conti news. If the victims do not pay, their data gets leaked and thousands of targets file trees are already floating around online. But what this also means is that we can start verifying the scams these hospitals were running because it isn't looking good.

We are under full blown attack and supply lines are under full blown attack. Your currency is under attack. Shills will claim we are not under attack because they are in on it. Shills will insult and deny, but they cannot address the evidence because they are literally too stupid to understand it and are paid what to think and say... zombies.

My point is, the lies are easily proven and everyone is sitting on their hands and the truth is the leaders of these seditious and foreign conspirators need to be tried and executed because that is literally the only thing that will stop them and they know it.

NuttBoxer says

they are literally attempting to become the hand of god and block billions of people from reproducing.

EBGuy says

NuttBoxer says

they are literally attempting to become the hand of god and block billions of people from reproducing.

I was just about to post Muh PBFs. I'm also getting a Berkey Filter for the same reason, the high levels of estrogenics in the water supply that may not be filtered out.

If you can post that again next year, good. Only tens of thousands of deaths from blood clots and anaphylaxis caused by the "vaccine".

If not, well, it will look like the conspiracy theorists were right.

Also, I've not heard great reports about China's vaccine program.
UAE to offer third Chinese vaccine dose amid efficacy concerns
The United Arab Emirates plans to offer a third Sinopharm shot to people who’ve already got two doses, amid concerns over the efficacy of the vaccine that’s been the cornerstone of country’s speedy inoculation program.

Patrick says

This is important enough that we should copy it:

This I call BS on. It's written by someone who doesn't understand DNA Sequencing or Next Gen DNA Sequencing. It's ALWAYS fragments. We don't have the tech yet to read through a whole genome. It always needs to be reassembled.

Also, on that note, despite what I'd said in another thread about false positives/negatives from PCR it's still probably the best tech out there to detect covid and when designed well should preform fantastically across a known (measured empirically) dynamic range. That means no 40 cycles of PCR bullshit.

We could in theory use DNA sequencing (metagenomics) to detect it as well but with normal sequencing (shallow) that would probably be $5K per sample and result in lots of FP or maybe $10K for very deep sequencing with less false positives but still false positives. That is cost prohibitive obviously.

That's just life. This is where we are with the state of the art techs.

just_passing_through says

Patrick says

This is important enough that we should copy it:

This I call BS on. It's written by someone who doesn't understand DNA Sequencing or Next Gen DNA Sequencing. It's ALWAYS fragments. We don't have the tech yet to read through a whole genome. It always needs to be reassembled.

Also, on that note, despite what I'd said in another thread about false positives/negatives from PCR it's still probably the best tech out there to detect covid and when designed well should preform fantastically across a known (measured empirically) dynamic range. That means no 40 cycles of PCR bullshit.

We could in theory use DNA sequencing (metagenomics) to detect it as well but with normal sequencing (shallow) that would probably be $5K per sample and result in lots of FP or maybe $10K for very deep sequencing with less false positives but still false positives. That is cost prohibitive o...

That's fine, but then someone who tests positive without any significant symptoms should be deemed NEGATIVE for all clinical purposes, allowed to travel anywhere and see whomever they see fit. To count them as covid cases is utter bullshit and abuse of the pcr. If people just stayed at home as an abundance of caution when experiencing symptoms until symptom free, then we wouldn't need anything else, not even tests or "vaccines", just therapeutics and I bet the curve of (excess) deaths would have looked exactly the same. If you're sick with a potentially infectious illness, stay at home and don't go to work. Done. The main use case for this test (besides for hospitalized patients) I can see would be for those who have severe allergies or other non infectious conditions, to make sure it's NOT covid when they have a severe attack during a pandemic.

No arguments from me that's for damn sure!

just_passing_through says

This I call BS on. It's written by someone who doesn't understand DNA Sequencing or Next Gen DNA Sequencing. It's ALWAYS fragments. We don't have the tech yet to read through a whole genome. It always needs to be reassembled.

I think the point was that there is not enough reliable DNA data to identify the covid strain supposedly wrecking havoc on the world. Even for NGS, you still need enough DNA to run an analysis and return meaningful results.

Again, not the first place I've heard this. And so far you're the only person I would consider reliable who has said otherwise.

NuttBoxer says

Even for NGS, you still need enough DNA to run an analysis and return meaningful results.

True story!

But!

You can PCR amplify it up! (giggles)

Patrick says

Shills will claim we are not under attack because they are in on it. Shills will insult and deny, but they cannot address the evidence because they are literally too stupid to understand it and are paid what to think and say... zombies.

Sound like anyone we know?