0
0

Not sure I trust Dr. Malone anymore


 invite response                
2023 Dec 22, 5:33pm   1,045 views  32 comments

by Patrick   ➕follow (59)   💰tip   ignore  

https://sagehana.substack.com/p/here-is-your-expert-3-two-clips-of


Two clips of Lifetime Bioweapons Industry Expert Dr. Robert Malone trying to shut down Reverse Transcription of mRNA warnings in 2021 and 2022

Specifically, does the COVID-19 vaccine reverse transcribe, integrate, and thus become part of human DNA in living, breathing humans? We had no answer to that question - until now.

Spoiler alert - the answer is yes - the mRNA Covid vaccine sometimes becomes a part of DNA. ...

Oh look, alleged twice jabbed Big Smartie Lifetime Bioweapons Guy tries to stop this exact line of discussion and warning in two different venues, Ron Johnson Empty Room Calm the Marks #2 and Daniel Nagase Zoom call.

https://rumble.com/vt62y6-covid-19-a-second-opinion.html

Robert Malone also had shut this warning down once before with Dr. Daniel Nagase.

https://danielnagase.substack.com/p/how-to-flip-a-double-or-triple-agent

One simple explanation is that Dr. Malone is trying to defend mRNA technology overall because he is still trying to capitalize on patents back from when he helped to develop the technology. For example, if a future influenza “vaccine” could be made using mRNA instead of the traditional method, and we wouldn’t want the current Pfizer and Moderna injections to be discredited “too” much. ...

However, another explanation may be that Dr. Malone has enough money already, but is being INSTRUCTED to stop narratives about mRNA changing DNA. ...

Well he definitely did try to “Control” my messaging about reverse transcriptase in November 2021.

IF Dr. Robert Malone is a double agent, who “used” to work for government and big pharma, and might still be working for government…

The situation as it stands right now is:

He’s lost control of the narrative.

EVERYONE IS TALKING ABOUT DNA CHANGES FROM mRNA injections.

A lot of people are noticing Dr. Malone try to divert attention away from genotoxicity (genetic damage) from mRNA.

Future value of mRNA patents are reduced no matter what he does now as no one sane will take an mRNA injection again.

Comments 1 - 32 of 32        Search these comments

1   Ceffer   2023 Dec 22, 5:40pm  

Patrick says

He’s lost control of the narrative.

This could come from persistent threats to his life, or his family's life and welfare, some other form of extortion or blackmail, or the now standard Globalist gang stalking. When a figure does a hard left against previous stands and principles, he has either been killed and name changed with a body double, or intimidated, or blackmailed. I would not suspect that mere monetary motives would have done this, if it has indeed happened, but he has changed his tune it seems.

Kerry Mullis was killed, but they didn't replace him with a body double, they just wanted him silenced.
2   Ingrid   2023 Dec 22, 5:41pm  

I have not trusted him from the beginning. Yes, he stood up and said the jabs were not safe. But he took them himself. It was known since 2012 that the product does not stay in the injection place. I just read that a few days ago. We had a discussion about him a few days ago, I think on Sasha Latypova's Substack, and some scolded me for calling him not very smart. Either that, or he is indeed still fishing to get a part of the cake. After all, he still holds patents to some of the products. But when you find out they are not good, you should stop it. When Fauci found out the jab and meds for Aids did not work, he should have immediately stopped. But these people know no grace. they just keep on going, poisoning people left and right, and spitting at those that put a finger on the sore spot ! I still get his substacks, because he has good memes. At least, he got taste in that LOL. (the not very smart part continued to his not knowing that green bell peppers are the not-yet-ripe version of red or yellow ones, and that the seeds of green ones do not germinate)
3   Ceffer   2023 Dec 22, 5:47pm  

Ingrid says

At least, he got taste in that LOL. (the not very smart part continued to his not knowing that green bell peppers are the not-yet-ripe version of red or yellow ones, and that the seeds of green ones do not germinate)

Wow. I am proud of myself. I'm as stupid as Dr. Malone. How many people can say that?
4   FortwayeAsFuckJoeBiden   2023 Dec 22, 7:48pm  

they come after Malone well
5   Bd6r   2023 Dec 22, 8:53pm  

Alternatively he does not want to kill off his own invention which is very human.
7   Ceffer   2023 Dec 25, 11:24am  

If Malone was a Tavistock Fabian advocate of population control from the beginning, was he complicit in the vaxicide then turned out as controlled opposition? They could have offered him the silver or the bullet and he decided to live and take the silver. Nazis and Russians don't hesitate to kill their scientists if they become annoying after their discoveries are preempted.

The map of most and least violent countries, if noted by proxies, would have the USA and that little country north of Italy and south of Germany in the deepest red.
8   just_passing_through   2023 Dec 25, 11:48am  

Interesting... I've seen a lot of his videos and some get pretty technical but are in my ballpark career wise and I found nothing to be alarmed about. Rather instead he basically shit canned the entire technology and dropped DoD bombs etc.,. (paraphrasing: (shakes fist: `They should have used antibodies instead!`))

He has his own rumble channel now though and the most recent (a bit old) video is him speaking with some lady about space aliens which I thought was pretty damn weird.
9   just_passing_through   2023 Dec 25, 11:59am  

Oh, btw, I saw the DNA integration article and the when they show a picture of the gel they ran they circled the friggin ladder not the samples. A ladder is just pieces of DNA that are a known length that you run through the porous gel alongside you samples. That way you can cross reference the length of DNA you cut out so you know it's length. (longer pieces move more slowly through the gel)

Who knows WTF they cut out and ran that gel on. Real proof since the 90s at least would be to sequence (read) the DNA so you could see all the AGCTs in order - then you know for certain what you have (barring error noise in the tech used).

They used PCR instead which is pretty lame:

Priming site (A bonds with T; G bonds with C):
ATCCTACTCAC <- small piece of primer DNA added to tube targeting what you want to amplify
TAGGATGAGTCCACCGAGAGATCAGGACGACGAGGACGAC <- Target DNA
Enzyme 'copies' the Target DNA ----------------------------------------> (now you have two copies )

You run that over and over (PCR cycling) then you have 4, 8 ... 1,000,000,000 copies.

You also add a dye that attaches to double stranded DNA which has 'the exact sequence' you are looking for and if it exists will start to glow (need a lot of DNA to see it, thus the copying (amplification). If it glows that's positive.

But they did a nested PCR (way more error prone for false positives) meaning they did some PCR, took a sample of that, then did it again because they were looking for something rare. PCR has lots and lots of error that's why people try to remove or minimize it from their experiments these days but you typically need a least a little.

Instead they could have just done maybe 5 PCR cycles (way less error noise in that) then used a special machine Boreal Genomics produces to filter out the haystack from the needles then done deep sequencing (a bit expensive but not too much these days) on an Illumina DNA sequencer.

If they had that experiment in the paper I'd believe it. Circling the DNA ladder in an ethidium bromide gel makes them look like buffoons.
10   just_passing_through   2023 Dec 25, 12:07pm  

This is a typical ladder that you run your samples against:



I'm also undecided whether or not it integrates. It certainly can, reverse transcriptase is a thing. This new article doesn't do it for me though. I'd heard rumors of some other group proving though and I never followed up. My guess if you inject billions of people with mRNA some of them (maybe A LOT) are going to get integration. In fact, the human genome is jam packed with retroviral dna going back through evolution. We wouldn't exist without it.

If you get a somatic mutation from it (somatic meaning 'self', then maybe it's in your heart, liver, skin) then it's self limiting. When you die it does too.
If you get a germline mutation from it (eggs and sperm), then it's passed down to your kidos and grand kidos etc.,
11   Ceffer   2023 Dec 25, 12:15pm  

Fiat Pandemic Fraud needs newspapers and government force for the fictions, not science.
12   just_passing_through   2023 Dec 25, 12:19pm  

yeah, it wasn't even a scientific paper so much as an article anyway... maybe there was a link I didn't see.
13   DhammaStep   2023 Dec 25, 12:36pm  

Let's say he's being told or threatened to shift the narrative of DNA transcription. Am I, a person who was vehemently against mRNA, going to take future mRNA shots because someone in the field tries to shift focus away from one (of many) flaw of the technology? The answer to that question is obviously no, I'm not going to change my mind based on one person's attempt at ignoring a flaw, no matter what I think of them.

The "pandemic" was very much a learning lesson on not trusting individuals but their underlying data and motives. If, for whatever reason, you decide to get a future mRNA jab because Malone says they don't write to your DNA, I only pity you. Don't take mRNA, period.
14   just_passing_through   2023 Dec 25, 12:50pm  

mRNA is in everything you eat. It's part of life. It mostly gets degraded in the gut though and in nature isn't protected inside little packets of lyposomes or LPNs. Some of it gets through. Pre-covid I've had lots of 'what if' discussions in labs with peers about what happens when it does. Putting it in things like lyposomes was a clear: we should never do that! though.

The mRNA injections aren't even real mRNA though but synthetic tweaked versions that last longer.
15   Patrick   2023 Dec 26, 8:52am  

He was definitely quite a cheerleader for the vaxx initially:

https://palexander.substack.com/p/were-these-2-twitter-posts-put-out






17   WookieMan   2023 Dec 26, 12:08pm  

I don't trust doctors or medicine that hasn't been tested for 20+ years at least. I'll die in an actual, real pandemic. So be it. I'm not taking anything that's not proven to not kill you. We still don't know with the covid vax. But i'd rather die quickly than have it dragged out for 5 miserable years if the "solution/vaccine" is just killing me anyway. The alternative is much shittier.
18   Patrick   2023 Dec 26, 12:17pm  

I agree.
19   Patrick   2023 Dec 26, 12:19pm  

just_passing_through says

The mRNA injections aren't even real mRNA though but synthetic tweaked versions that last longer.


@just_passing_through

Why does pseudo-uridine not occur naturally? I guess our enzymes are just not set up to create that.
20   just_passing_through   2023 Dec 26, 12:25pm  

The "U" base in mRNA is supposed to be Uracil not pseudo-uridine.
21   Shaman   2023 Dec 26, 1:26pm  

Any thoughts on this?
Frameshifting because the modRNA tends to fall off the ribosome at random, something like a quarter of the time, producing incomplete proteins which are themselves immunoreactive?
https://www.nature.com/articles/s41586-023-06800-3
22   mell   2023 Dec 26, 8:02pm  

Shaman says

Any thoughts on this?
Frameshifting because the modRNA tends to fall off the ribosome at random, something like a quarter of the time, producing incomplete proteins which are themselves immunoreactive?
https://www.nature.com/articles/s41586-023-06800-3

iirc this is very similar to molecular mimicry, which has been an issue with many products deemed "safe". It also causes immune reactions because mistaken for a very similar invader.
23   GNL   2023 Dec 26, 8:30pm  

If I had to make my decision to take or not take the jab based on what just_passing_through has posted, I would have just flipped a coin. No, the only way a person like me could have made, what I believe has been, the right decision is by the ridiculousness of the media and government. It was clear to me very early on that this was a nonevent. I'm not a high IQ person but, the information was there and it was clear when taking time to logically think through all the bullshit they were saying.
24   just_passing_through   2023 Dec 27, 10:56am  

Well obviously I was just describing DNA integration. I don't think there is any question it causes strokes, heart problems etc., in particular in younger people so it's a no brainer to skip (at this point and shortly after it all started).

I hadn't heard of the molecular mimicry issue but that sounds plenty messed up too.
25   GNL   2023 Dec 27, 1:38pm  

I'm just saying that a person like me would find it almost impossible to make sense of what you're saying and to make the right decision based on it. I realize that says something about me.
26   Bd6r   2023 Dec 27, 4:56pm  

Swatters should get


28   WookieMan   2023 Dec 31, 3:01am  

GNL says

I'm just saying that a person like me would find it almost impossible to make sense of what you're saying and to make the right decision based on it. I realize that says something about me.

Just don't take anything at this point. I'll take proven vaccines that have been tested for decades. I was a kid then though. Don't put something in your body you don't trust or know has side effects unless it keeps you alive. I don't take pain killers for example. Suck it up buttercup (not directed at you).

We put too many people on meds for minimal, if not zero reason. It's in their head. So they take a placebo that damages their organs. I recently dropped a 5lbs pot lid for cooking on my foot. Mostly sure there's a minor fracture. Whatever. I can walk. It hurts. A barking body is one you need to listen to, not cover up with drugs that may get you addicted to opioids.
29   Robert Sproul   2023 Dec 31, 7:59am  

Some of Malone's accusers seem obviously corrupt and self-serving, like Stew Peters and probably Peter Breggin and the Wellness Company Boy Billionaire. Others seem more sincere like Sage Hanna and Yeadon. It is all likely an Alphabet Agency orchestrated-movement-destroying-cluster-fuck, planned since the very start of the Op.
Here is Malone defending himself.
https://rwmalonemd.substack.com/p/mission-creeps-culture-warriors-that
30   ElYorsh   2024 Jan 10, 1:39pm  

Why is a "scientist" so involved in politics?


31   Patrick   2024 Feb 27, 10:05am  

https://sashalatypova.substack.com/p/famoti-gate


Sage Hana did a very detailed analysis of the Pepcid saga, and I am not going to repeat the whole thing - all receipts are here in his post. TLDR version:

Robert Malone was definitely contracted by the DOD/DTRA at the time - this is documented on his 2021 CV.

DTRA’s effort was orchestrated to look like they were searching for repurposed drugs, but it was fixed to promote their own asset - remdesivir (main component of the covid hospital murder protocol that generated the bulk of the “pandemic” they needed). From DTRA article: “Originally developed as an Ebola Zaire countermeasure, this DTRA-funded inhibitor transitioned for more advanced testing due to promising pre-clinical trials. Remdesivir inhibits viral replication in a wide variety of pathogens and was one of the first therapeutics identified in the Defense Department for repurposing to treat COVID-19.”

Pepcid (famotidine) was a decoy which did nothing but give legitimacy to the whole faked science effort. It would have looked too conspicuous if there was onl 1 or only 2 frontrunners.

Important! Funding for the Malone study came from the DOD, DTRA and DARPA:

This material is based upon work supported under Air Force Contract No. FA8702-15-D-0001. Any opinions, findings, conclusions or recommendations expressed in this material are those of the author(s) and do not necessarily reflect the views of the U.S. Air Force. Funding was also provided by grants from the Defense Advanced Research Projects Agency HR0011-19-2-0020 (to A. G-S.); by CRIP (Center for Research for Influenza Pathogenesis), a NIAID supported Center of Excellence for Influenza Research and Surveillance (CEIRS, contract # HHSN272201400008C) and by supplements to NIAID grant U19AI135972 and DoD grant W81XWH-20-1-0270 to A.G.-S.

...

First, let me address Robert’s very clear conflict of interest that most freedom movers prefer to ignore - he was (and still is!) under contracts with the US Government, the DOD and DTRA. Even if he is no longer performing any science projects, real or faked, he is still under non-disclosure agreements. 29 sec clip from around 15 min into the interview...

Transcript:

AM: “Do you have any current contracts of confidentiality agreements with US Gov?”

RM: “No. I have existing non-disclosure agreements and those typically last 5-10 years.”

AM: “How many more years left on them?”

RM: “Probably another 4-5.”

Here is the OTA covid countermeasures contract awarded to Inovio (the company Bob states he started) by the DOD on June 20, 2020. It was for the development of a prototype DNA vaccine for Covid-19 using an electroporation device. Translation: this is a way to drive DNA plasmids into your skin, i.e. transfect your largest organ with DNA plasmids containing chimeric genetic sequences and antibiotic resistance genes! But it’s for the good cause - to save your granny and for warfighter readiness…This contract has extensive confidentiality provisions and its term is redacted. It may very well be current today. ...

He also states in the interview that he has never worked for the CIA, but “forgets” to mention DOD/DTRA that are on his resume. That’s a good one, Bob!

I am searching for the right word here… searching … searching … ah! I think the word I am looking for is “controlled”. Bob is controlled by these still enforceable agreements with the US Government and the DOD. The existence of the DOD leash explains his otherwise erratic, unprofessional, bordering on incompetent behavior throughout the interview. He is doing a job.
32   Patrick   2024 Apr 24, 9:44pm  

https://palexander.substack.com/p/boom-i-we-were-always-100-re-malone


On September 13, 2021, Hatfill, Malone and a number of other speakers gave presentations to the Italian senate. This meant that Stefano and Roberto had to hop aboard a plane and travel to Italy.

This trip to Italy, remember, is over four months after Malone claimed to have received the second of his Moderna shots.

Curious then, that Hatfill recalls how he and Sly Malone had to submit to rapid antigen tests in Italy because they were both unvaccinated.

“I’m not vaccinated, I don’t have a card” says Hatfill.

“Neither did Dr Malone,” adds Hatfill with a big grin, “he didn’t have a card.”

Please register to comment:

api   best comments   contact   latest images   memes   one year ago   random   suggestions