patrick.net

Michael Knowles Has Created A Pledge For Congressional Candidates To Sign Saying They'll Investigate Dr. Fauci And It's The Greatest Thing Ever

This may be my favorite thing I've seen all day.

The Daily Wire's Michael Knowles, who has been one of the leading voices coming out against wannabe public health dictator Dr. Fauci since the beginning of the pandemic, has come up with a pledge for congressional candidates to sign.

Here's what the Daily Wire star tweeted out:



The best part is that this is actually working, several congressional candidates have signed the pledge to investigate Fauci.

The Department of Health and Human Services (HHS) and one of its offices are allegedly refusing to abide by requests from members of Congress for more information regarding a U.S. government grant to a Chinese laboratory that’s situated near where the CCP (Chinese Communist Party) virus first appeared.

HHS and the National Institutes of Health (NIH) have refused to produce records regarding the 2014 grant from the NIH to EcoHealth Alliance, which funneled the money to the Wuhan Institute of Virology (WIV), Rep. James Comer (R-Ky.) and 18 other lawmakers said in a Feb. 2 letter (pdf) to the heads of the agencies.

Who exactly is the enemy that the CIA is targeting these days?

From the 1950s through the 1980s the CIA overthrew democratically elected governments and assassinated leaders in the U.S. and around the world in the name of fighting communism.

After the fall of communism, the CIA pivoted to fighting terrorism. After 9/11 their mission expanded considerably to include a global network of black sites where they conducted torture. They also engage in covert military operations on the ground inside a wide range of countries.

More recently, the CIA has expanded their mission yet again. We have evidence of coordination between the U.S. Department of Defense, Fauci, the EcoHealth Alliance, bioweapons labs in the U.S., and the Wuhan Institute of Virology (a Chinese bioweapons lab) to conduct gain-of-function research. This has all of the hallmarks of a CIA operation.

One could make the case that the CIA is now fighting viruses/pandemics in the name of national defense. But this effort CREATED the chimera virus that has killed more Americans than all foreign wars combined. Since the chimera virus was released, governments across the developed world, Pharma, and Big Tech have all worked together to control the message, surveil and censor the population, and smash any dissent. Again this reeks of CIA involvement.

So my question is, who/what exactly is the CIA fighting these days? My hunch is that the answer is us. Not just the medical freedom movement (although we are certainly targeted) but the general public. This seems like a class war and the CIA’s new mission is not to defend the U.S. per se but rather to defend the global ruling class from the peasants who might overthrow them.

The Bat Lady from Wuhan and the Very Clumsy Lies She Tells ...

Note all of the bizarre coincidences you must live with, if you believe SARS-2 has natural origins: You have to imagine the virus just happened to enter humans via some zoonotic event in Wuhan, the only city on earth with a lab devoted to sampling and culturing SARS-related bat coronaviruses like SARS-2, where its closest known relative also just happened to be sitting in a freezer. And we haven’t even gotten to the furin cleavage site yet.

Michael Knowles Has Created A Pledge For Congressional Candidates To Sign Saying They'll Investigate Dr. Fauci And It's The Greatest Thing Ever

this guy who won a big important prize for strategy just deleted his twitter account.




weird, huh?

i wonder what the strategy behind that was…

Trust the science.
Alex Berenson 4 hr ago

Step 1: Even though the world has not had a major respiratory disease epidemic in almost a century, insist one is coming SOON and we have to swab every bat in China to figure what virus will cause it.

Step 2: When you can’t find viruses capable of causing it, start making them more dangerous in a lab.

Step 3: When an epidemic finally breaks out IN THE CITY WHERE THE LAB IS, shout down anyone who mentions the connection. Instead spend two years instituting control measures that prove completely ineffective at stopping it - though very effective at ruining kids’ mental health.

Step 4: Invent “vaccines” that work against the virus in a completely novel way, test them for months, and give them to more than a billion people.

Step 5: Be surprised when the vaccines turn out to be far more effective than the virus itself at causing immune imprinting and original antigenic sin.

Step 6: Wonder why the outbreak has lasted far longer than previous outbreaks, when neither control measures nor vaccines were used.


Step 7: Call anyone who points these unpleasant facts out a conspiracy theorist; when that doesn’t work, censor them.

Step 8: Profit!

This week, in response to ongoing litigation over the release of public records related to coronavirus research funded by National Institutes of Health, the NIH sent The Intercept (magazine) 292 fully redacted pages rather than substantive material that they requested. These pages could have helped us to understand how the virus first came to infect humans. Below is one of the 292 pages that The Intercept received:

In order words, The Intercept received 292 completely blanked-out pages and a few pages almost completely redacted. So, what is the NIH hiding when it comes to their role in the gain of function research that developed the SARS-CoV-2 virus that causes COVID-19?

More evidence Covid was tinkered with in a lab? Now scientists find virus contains tiny chunk of DNA that matches sequence patented by Moderna THREE YEARS before pandemic began
Genetic match discovered in Covid's unique furin cleavage site on spike protein
Matched genetic sequence patented by Moderna for cancer research purposes
Researchers say one in 3trillion chance Covid developed the code naturally

23 February 2022

Moderna Wins Initial $20M Grant from Gates Foundation
January 12, 2016

Moderna Therapeutics said today it received an initial $20 million grant from the Bill & Melinda Gates Foundation to develop a new affordable combination of messenger RNA–based antibody therapeutics geared toward preventing HIV infection.

Where’s Fauci? Infamous bureaucrat now relegated to obscure shows and local TV
Fauci recently appeared on a show called “Woke AF.”

Did Rand Paul let go of the idea of locking him up?

In 2014, Fauci’s agency had issued a $3.7 million grant to EcoHealth Alliance, a nongovernmental organization dedicated to predicting and helping to prevent the next pandemic by identifying viruses that could leap from wildlife to humans.

What is unbearably clear at this point is that this gang’s obsession with covering up a possible lab leak, in the interest of keeping their own fingerprints off the deed, completely distracted the leadership of the National Institutes of Health from what it was supposed to be doing at the time. And what was that? It’s not complicated. If you have a new pathogen sweeping a country, you want to focus on ways to keep vulnerable populations safe (for example, not forcing nursing homes to admit Covid-infected people) and discovering the best therapeutics to minimize severity for the general population.

This is not what happened. Instead, we had a plot against the US president, the deliberate cultivation of mass panic, forced closures of schools and businesses, wild demands for mass human separation, travel restrictions, ineffective mask and vaccine mandates, and the general triumph of crank science over experience, at the great cost of human liberties and rights and hence social and economic well-being.

Gain-of-Function Smashing Success: The Key Sequence Inserted in the SARS-CoV-2 Virus Added at Least FOUR Distinct Functions. Coincidence?
Unpacking the evil genius of TATCAGACTCAGACTAATTCTCCTCGGCGGGCACGT

Ashmedai

If Fauci was a hedge fund manager, he would outperform the stock market by a wide margin. The man always gets his money’s worth from the numerous grants worth billions of dollars that he dispenses annually. His track record of producing the desired research results is so consistent that Vegas would be quickly bankrupted if they would allow people to bet on what the results of a Fauci-sponsored study would be. And as we shall see, the ROI for his Gain-of-Function grants was absolutely stupendous.

There is heightened interest in the origin of covid-19, especially now that the world has more or less acknowledged its likely laboratory provenance. A veritable flood of documents have been publicized chronicling the progress and evolution of the gain-of-function research and experiments leading up to the “emergence” of covid. ...

Alarmingly, the scientists who designed the vaccines were incredibly sloppy and shortsighted. In their myopic desire to squeeze out every last drop of potential protein production, they put all their efforts into ensuring that the mRNA wouldn’t degrade and maximizing the yield of every strand of mRNA to the extent humanly possible. One of the tactical choices made was employing codon optimization all throughout the spike genome. (There were a few other reckless choices as well.) They never considered that recklessly modifying the virus genome for the vaccine product could lead to unintended consequences. ...

Ultimately, we have no idea of what potentially toxic mutant peptides might be produced in relevant quantities, and where in the anatomy such toxicities might be manifest; and nor do we know how this affects the immune system. That we are burdened by such profound unknowns regarding the vaccine products is a testament to the utter and complete collapse of the regulatory regime.

Democrats now interpret all data through the lens of The Narrative(TM) that makes Dems look like heroes, Pharma look like Gods, and Republicans look like unwashed barbarians who deserve death for their failure to obey their betters. It’s not so much science as bougie-supremacy. Self-reflection, paradox, and admitting mistakes are of course banned from the bougie lexicon.

In this short article, I’ve stolen his title (in hopes of messing with the search engines) and I set the record straight. Any honest assessment of the last two years leads to the inexorable conclusion that every facet of the pandemic is a direct result of the intellectual and moral failures of the “expert class” itself.

1. Tony Fauci created the pandemic by funding risky gain-of-function research at a bioweapons lab in Wuhan China. Somehow a chimera virus, engineered to be more lethal to humans, escaped. No Tony Fauci, no pandemic. All else flows from this.

2. Fauci, the FDA, and CDC blocked access to prophylaxis and early treatment. The CDC’s own research showed that chloroquine is safe and effective for prophylaxis and early treatment of SARS coronaviruses (hydroxychloroquine is even safer than chloroquine). The U.S. had a massive stockpile for this very purpose that was never used. About 90% of Covid-19 fatalities in the U.S. could have been prevented if public health officials had followed proper protocols and used about twenty off-the-shelf treatments that are safe and effective. Instead the FDA and CDC ridiculed the best treatments, stopped doctors from prescribing them, and prohibited pharmacies from filling these prescriptions.

3. Hospitals used the wrong protocols and continue to use the wrong protocols. Failing to provide early treatment (turning people away from hospitals to preserve capacity), ventilators, and Remdesivir are all death sentences. Large hospitals have such abysmal outcomes because they used the wrong protocols and they seem to have no ability to course-correct based on actual data.

4. Blue states that followed the CDC’s advice to return Covid+ patients to nursing homes committed senicide — the systematic murder of the elderly. The death toll in the elderly was and is so high because they were never provided prophylaxis, immune support, nor any early treatment and their residences were intentionally seeded with the sick — once again in the misguided attempt to preserve hospital capacity(TM).

5. Promoting mass injections with negative efficacy, keeps the pandemic going indefinitely. These useless shots also seem to be driving the evolution of variants. The pandemic will never end as long as the government continues to promote these mRNA shots that lack sterilizing immunity.

The entire pandemic, from the origins, through the early days, until now, is a self-inflicted, man-made crisis. This is iatrogenic pandemicide — created, spread, and made more deadly by the people who claim that they are “experts”. Everything that public health has done for two years has made things significantly worse. As long as the people who are wrong about everything remain in power, the crisis will continue.

On Wednesday, Lawrence Tabak, the acting director of the National Institutes of Health (NIH), confirmed during congressional testimony that officials at the NIH deliberately withheld crucial information about early genomic sequences of the COVID-19 virus on the orders of Chinese scientists.

Health authorities in the two continents have thus far identified only a few dozen cases. And while there’s no reason for concern at the moment, here’s what convinced me to put this on your radar.

Late last night, the U.S. government decided to order millions of doses of monkeypox vaccine. ...

The U.S. likely has first dibs on the product because the vaccine was developed with American support. Anthony Fauci’s NIAID has supported Bavarian Nordic with well over $100 million in grants. Whether Fauci and his colleagues will receive kickbacks and royalties for this vaccine remains unknown.

Bavarian Nordic received FDA approval for its vaccine in September of 2019, just two months before the commencement of COVID Mania. ...

Early reports from Europe seem to indicate that Monkeypox is only spreading within the gay community, as cases are being reported exclusively in gay men. The transmission dynamics remain unclear, but that hasn’t stopped the usual panic promoters from making hysterical claims.

i like to allow people to state their positions in their own words. it’s no fair making up what they said or paraphrasing to rob them of nuance and of full expression.

so hear tony out.

because he speaks here with clarity and with nuance.

the year was 2017. he’s speaking about the smallpox vaccine. and he clearly understands risk/reward.

smallpox is a disease FAR deadlier than covid.

the smallpox vaccine has a severe adverse events rate that is easily 1/100th that of the covid vaccines (and probably quite a lot less than that. could easily be 1/1000th or less)

AND it’s a one and done vaccine. you get the shot and you generate lifelong sterilizing immunity. you won’t get smallpox or spread it. you really are the “dead end” tony famously claimed the covid vaccinees would be.

and yet he says we should not bring it back because the vaccine has some rare side effects and this outweighs the benefit.